Review



m13mp18 single stranded dna  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    New England Biolabs m13mp18 single stranded dna
    M13mp18 Single Stranded Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 869 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m13mp18+dna/pm42108594-127-0-7?v=New+England+Biolabs
    Average 96 stars, based on 869 article reviews
    m13mp18 single stranded dna - by Bioz Stars, 2026-07
    96/100 stars

    Images



    Similar Products

    96
    New England Biolabs m13mp18 single stranded dna
    M13mp18 Single Stranded Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m13mp18+dna/pm42108594-127-0-7?v=New+England+Biolabs
    Average 96 stars, based on 1 article reviews
    m13mp18 single stranded dna - by Bioz Stars, 2026-07
    96/100 stars
      Buy from Supplier

    96
    New England Biolabs m13mp18 scaffold
    M13mp18 Scaffold, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m13mp18+dna/pmc13178635-49-7-9?v=New+England+Biolabs
    Average 96 stars, based on 1 article reviews
    m13mp18 scaffold - by Bioz Stars, 2026-07
    96/100 stars
      Buy from Supplier

    96
    New England Biolabs tet
    Denaturing PAGE (10%) showing the results of primer-extension assay with wild-type Pol ε and its variants. Extension of a <t>5′-TET-labeled</t> 50-mer primer annealed to an 80-mer template. The reactions were stopped at 0, 2, 5, and 15 min, respectively.
    Tet, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m13mp18+dna/pmc13036494-47-15-12?v=New+England+Biolabs
    Average 96 stars, based on 1 article reviews
    tet - by Bioz Stars, 2026-07
    96/100 stars
      Buy from Supplier

    96
    New England Biolabs processivity assays
    Denaturing PAGE (10%) showing the results of primer-extension assay with wild-type Pol ε and its variants. Extension of a <t>5′-TET-labeled</t> 50-mer primer annealed to an 80-mer template. The reactions were stopped at 0, 2, 5, and 15 min, respectively.
    Processivity Assays, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m13mp18+dna/pmc13036494-47-3-12?v=New+England+Biolabs
    Average 96 stars, based on 1 article reviews
    processivity assays - by Bioz Stars, 2026-07
    96/100 stars
      Buy from Supplier

    96
    New England Biolabs 35 mer oligonucleotide tet cccagtcacgacgttgtaaaacgacggccagtgcc
    Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled <t>35–mer</t> oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.
    35 Mer Oligonucleotide Tet Cccagtcacgacgttgtaaaacgacggccagtgcc, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m13mp18+dna/pmc13036494-47-16-12?v=New+England+Biolabs
    Average 96 stars, based on 1 article reviews
    35 mer oligonucleotide tet cccagtcacgacgttgtaaaacgacggccagtgcc - by Bioz Stars, 2026-07
    96/100 stars
      Buy from Supplier

    96
    New England Biolabs m13mp18 single stranded dna scaffold
    Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled <t>35–mer</t> oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.
    M13mp18 Single Stranded Dna Scaffold, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m13mp18+dna/pmc13041751-138-1-8?v=New+England+Biolabs
    Average 96 stars, based on 1 article reviews
    m13mp18 single stranded dna scaffold - by Bioz Stars, 2026-07
    96/100 stars
      Buy from Supplier

    96
    New England Biolabs m13mp18 ssdna
    Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled <t>35–mer</t> oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.
    M13mp18 Ssdna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m13mp18+dna/10__1016_slash_j__mtbio__2026__103092-73-8-23?v=New+England+Biolabs
    Average 96 stars, based on 1 article reviews
    m13mp18 ssdna - by Bioz Stars, 2026-07
    96/100 stars
      Buy from Supplier

    96
    New England Biolabs prepared y annealing m13mp18 single stranded dna
    Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled <t>35–mer</t> oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.
    Prepared Y Annealing M13mp18 Single Stranded Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/m13mp18+dna/pm41914498-47-37-43?v=New+England+Biolabs
    Average 96 stars, based on 1 article reviews
    prepared y annealing m13mp18 single stranded dna - by Bioz Stars, 2026-07
    96/100 stars
      Buy from Supplier

    Image Search Results


    Denaturing PAGE (10%) showing the results of primer-extension assay with wild-type Pol ε and its variants. Extension of a 5′-TET-labeled 50-mer primer annealed to an 80-mer template. The reactions were stopped at 0, 2, 5, and 15 min, respectively.

    Journal: Nucleic Acids Research

    Article Title: A thumb-domain insertion balances processivity and fidelity in DNA polymerase ε

    doi: 10.1093/nar/gkag282

    Figure Lengend Snippet: Denaturing PAGE (10%) showing the results of primer-extension assay with wild-type Pol ε and its variants. Extension of a 5′-TET-labeled 50-mer primer annealed to an 80-mer template. The reactions were stopped at 0, 2, 5, and 15 min, respectively.

    Article Snippet: The substrate for processivity assays was prepared by annealing M13mp18 single-stranded DNA (NEB) with a 5′-TET–labeled 35-mer oligonucleotide (TET-CCCAGTCACGACGTTGTAAAACGACGGCCAGTGCC) in equimolar amounts in 125 mM NaAc (pH 7.8).

    Techniques: Primer Extension Assay, Labeling

    Denaturing PAGE (10%) showing the results of primer-extension assay with wild-type Pol ε and its variants. Extension of a 5′-TET-labeled 50-mer primer annealed to an 83-mer template containing a hairpin. The reactions were stopped at 0, 2, 5, and 15 min, respectively.

    Journal: Nucleic Acids Research

    Article Title: A thumb-domain insertion balances processivity and fidelity in DNA polymerase ε

    doi: 10.1093/nar/gkag282

    Figure Lengend Snippet: Denaturing PAGE (10%) showing the results of primer-extension assay with wild-type Pol ε and its variants. Extension of a 5′-TET-labeled 50-mer primer annealed to an 83-mer template containing a hairpin. The reactions were stopped at 0, 2, 5, and 15 min, respectively.

    Article Snippet: The substrate for processivity assays was prepared by annealing M13mp18 single-stranded DNA (NEB) with a 5′-TET–labeled 35-mer oligonucleotide (TET-CCCAGTCACGACGTTGTAAAACGACGGCCAGTGCC) in equimolar amounts in 125 mM NaAc (pH 7.8).

    Techniques: Primer Extension Assay, Labeling

    Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled 35–mer oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.

    Journal: Nucleic Acids Research

    Article Title: A thumb-domain insertion balances processivity and fidelity in DNA polymerase ε

    doi: 10.1093/nar/gkag282

    Figure Lengend Snippet: Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled 35–mer oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.

    Article Snippet: The substrate for processivity assays was prepared by annealing M13mp18 single-stranded DNA (NEB) with a 5′-TET–labeled 35-mer oligonucleotide (TET-CCCAGTCACGACGTTGTAAAACGACGGCCAGTGCC) in equimolar amounts in 125 mM NaAc (pH 7.8).

    Techniques: Labeling

    Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled 35–mer oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.

    Journal: Nucleic Acids Research

    Article Title: A thumb-domain insertion balances processivity and fidelity in DNA polymerase ε

    doi: 10.1093/nar/gkag282

    Figure Lengend Snippet: Denaturing PAGE (8%) showing the impact of absence/presence of PCNA on processive leading strand synthesis by wild type Pol ε and its variants. Extension of a 5′-TET-labeled 35–mer oligo annealed to M13mp18ssDNA (NEB). Reactions were performed at 40-fold molar excess of DNA substrate over polymerase to meet single-hit criteria. Individual reactions were stopped at 0, 2, 5, and 15 min, respectively.

    Article Snippet: The substrate for processivity assays was prepared by annealing M13mp18 single-stranded DNA (NEB) with a 5′-TET–labeled 35-mer oligonucleotide (TET-CCCAGTCACGACGTTGTAAAACGACGGCCAGTGCC) in equimolar amounts in 125 mM NaAc (pH 7.8).

    Techniques: Labeling